|
|
|
Re: Does the punishment fit the crime for child porn?
Fri, 20 Nov 2009 18:32:03 +0000
On Fri, 20 Nov 2009 10:09:47 -0800 (PST), Ste <ste_rose0@hotmail.com>
wrote:
>Well I invite you to lay out a definition of paedophile that is
>neither broader nor narrower than what most people apprehend its
>definition to be.
I would be interested to hear Nigel's explanation of what the major
*differences* ...
|
Re: Dodgy Picture? [continued from ULM]
Fri, 20 Nov 2009 10:03:20 -0800 (PST)
[OK, seeing that you obviously know different, please post or email me
>with the URL of three such sites. AFAIAA publishing the URL of such
>sites is not illegal
Actually, it would be (advertising is illegal too), but that's not the
main reason why I won't be doing this.]
No it is not, it depends on how it is ...
|
www.cheapsneakersale.com cheap MBT SNEAKERS,wholesale cheap true religion jeans,discount prada gucci sneakers,wholesale cheap jordan sneakers,moncler coat for sale
Fri, 20 Nov 2009 23:24:19 +0800
Www.cheapsneakersale.com discount ed hardy hoody,christian audigier clothing
on sale
www.cheapsneakersale.com discount true religion jeans,wholesale adidas
tracksuit
www.cheapsneakersale.com buy cheap nike dunk SB trainers,gucci sneakers,
wholesale prada tshirts on sale,discount burberry tshirts for men
www.ch ...
|
Re: Dodgy Picture? [continued from ULM]
Fri, 20 Nov 2009 17:47:29 +0000
In message <rja8g5ps1h78dm20n1igeknj2547nhadva@4ax.com>, at 17:18:16 on
Wed, 18 Nov 2009, Cynic <cynic_999@yahoo.co.uk> remarked:
>On Wed, 18 Nov 2009 16:05:36 +0000, Roland Perry <roland@perry.co.uk>
>wrote:
>
>>>I could just as well ask for the URL of a site that is offering child
>>>porn for payment. I've n ...
|
Re: Dodgy Picture? [continued from ULM]
Fri, 20 Nov 2009 17:29:22 +0000
In message <6uh0SXFk+BBLFwKd@obviously.invalid>, at 16:24:04 on Wed, 18
Nov 2009, Big Les Wade <Les@nowhere.com> remarked:
>Roland Perry <roland@perry.co.uk> posted
>>There's always a conspiracy, isn't there?
>
>There certainly is a conspiracy to deliver forged 404s in place of
>blacklisted websites. Where org ...
|
The History of Espionage for the Entertainment of Entertainers
Fri, 20 Nov 2009 07:05:48 -0800 (PST)
The History of Espionage for the Entertainment of Entertainers
Fast Forward to c1990's The Entertainment of Hindi Serfs
Information on Terrorist Activity: http://bit.ly/SIMEarth_FAILED
Operation SCARED STRAIGHT: http://bit.ly/ScaredStraight
World Peace as ATTAINABLE scheduled for 2001.
Full document & pic ...
|
DNA can now be faked : "The free rides over"
Fri, 20 Nov 2009 06:59:46 -0800 (PST)
Came across this after watching the latest "Law & Order:SVU" ... the
quote in the subject is from the character who does the (fictional)
faking in the show.
I would suggest this news is of great interest to anyone preparing a
defence in a case where DNA is the primary evidence ....
August 18, 2009
DNA Ev ...
|
They may have found policeman's body
Fri, 20 Nov 2009 13:52:39 -0000
http://news.bbc.co.uk/1/hi/uk/8369934.stm
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
...
|
Re: Fat Cat Nurses
Fri, 20 Nov 2009 13:04:56 +0000
On Fri, 20 Nov 2009 13:00:06 -0000, "Ret." <xxx> wrote:
>> Do you know of any case where someone has phoned the emergency
>> services due to a suspected heart attack, and been told that an
>> ambulance will be despatched sometime next week?
>
>There are plenty of newspaper articles about long delays in waiting ...
|
Imprisonment without trial in the UK.
Thu, 19 Nov 2009 22:55:56 -0800 (PST)
Of course this happens on routine basis with immigrants but also
sometimes to UK citizens as well. If he had killed someone with a car
he would have been let out on bail but as a political protester the
book is thrown at him.
"10 months ago, on 18 January 2009, Elijah Smith A former British
Soldier was arrested ...
|
|
|
